WBAntibody00002944

Rabbit polyclonal antibody against CeINCENP. To make GST fusion proteins to generate antibodies to CeINCENP (cgcgcgggatccgaaaccgacgaagtgcagac, gcgcgcgaattctcaatcattgaacggaatcacac) the primers in parentheses were used to amplify fragments of the corresponding genes from cDNAs. icp-1

WBAntibody00002746

A polyclonal antibody against JMJD-1.2 was generated by Innovagen AB (IDEON Gamma Rec. Solvegatan 41 SE-22362 Lund, Sweden), by immunizing rabbits with a purified bacterial GST-tagged fragment of the JMJD-1.2 protein encoded by the first four exons of the gene. The antibody was affinity purified. jmjd-1.2

WBAntibody00000570

Rabbit polyclonal antibodies (EU102) to a 352-residue region (4215-4567) that contains Ig domains 18 and 19 and 150 amino acid residues beyond, and is just N-terminal to the PEVT/K region. On the basis of the Ce titin gene structure, it would be expected that EU102 would react with the 2.2 MDa and 1.2 MDa isoforms. ttn-1

WBAntibody00000418

Polyclonal rabbit antibody against DCR-1 recombinant protein. Polyclonal antisera were raised against a protein fragment encoded by the two C-terminal exons of the K12H4.8 gene. The protein fragment was isolated from inclusion bodies and further purified using a C-terminal 6His tag. Both rabbits produced antibodies that are capable of precipitating a fraction of the Dicer. dcr-1

WBAntibody00000873

A single-chain Fv antibody (scFv) against Y110A2AL.14 protein was obtained from a library of 109 unique antibody-phage. An antibody-phage display method was used to isolate recombinant antibodies that bind to Y110A2AL.14, the C. elegans Gal-T2 protein. Recombinant antibodies were obtained from a library of human single-chain variable antibody fragments (scFv), fused to M13 gene III. sqv-2

WBAntibody00002885

cpl-1 (NM_ 001269789) gene was amplified by PCR and constructed into the prokaryotic expression plasmid (pET28a). Then, the recombinant protein was expressed in the BL21 E. coli expression system and purified. After that, the recombinant protein was injected into the rabbit, and the serum was collected. Finally, we detected the titer at 1:256,000 using enzyme-linked immunosorbent assay and identified good specificity using western blot. cpl-1

WBAntibody00002833

Briefly, for the UNC-38 antibody, a DNA fragment encoding 375-418 amino acids of the UNC-38 gene was cloned in pGEX-5X. The GST::UNC-29 and GST::UNC-38 fusion proteins were then expressed in BL21 E. coli cells and purified. This fusion protein was then injected into the rabbits and rabbits were boosted with 100 μg each time. The antibody was then purified and used for experiments. The antibody production and purification was performed by Bioklone Biotech Pvt. Ltd, Chennai, India. unc-38

WBAntibody00002832

Briefly, for the UNC-29 antibody, a DNA fragment encoding 348-431 amino acids of the UNC-29 gene was inserted into pGEX-5X. The GST::UNC-29 and GST::UNC-38 fusion proteins were then expressed in BL21 E. coli cells and purified. This fusion protein was then injected into the rabbits and rabbits were boosted with 100 μg each time. The antibody was then purified and used for experiments. The antibody production and purification was performed by Bioklone Biotech Pvt. Ltd, Chennai, India. unc-29

WBAntibody00002939

To generate the mouse monoclonal anti-PARG-1(2D4) antibody, the cDNA encoding for residues 1-350 of C. elegans PARG-1 (isoform A) was generated by gene synthesis (IDT) and then cloned into pCoofy31 in frame with a C-ter 6 × His tail. The resulting plasmid was expressed in E. coli BL21 cells according to standard procedures and 1 mg of purified protein was used to immunize three mice in the 'in-house' monoclonal antibody facility at Max Perutz Laboratories. parg-1

WBAntibody00002768

The N-terminal portion (aa 4-77) of CYB-1 was cloned into a maltose-binding protein (MBP)-tagged 6xHis vector, pYS, as follows. First, the MBP gene was PCR-amplified from pHIT198 (a gift from H. Tabara, Tsukuba University, Kyoto, Japan) and cloned into pET- 28a(+) (Novagen, 69864-3) by means of the DNA Ligation Kit Mighty Mix (Takara, 6023) to generate pYS. Second, the N-terminal portion (aa 4-77) of CYB-1 was amplified from yk1306b09 (a gift from Y. Kohara, National Institute of Genetics, Mishima, Japan) and cloned into the pYS vector. The CYB-1-MBP-6xHis fusion protein was expressed and affinity-purified using His-Bind Agarose Resin (ELPIS-BIOTECH, EBE-1031). It was then injected into rats as an antigen to raise an anti-CYB-1 antibody (AbFrontier). This antibody was then affinity-purified from the crude serum, using 6xHis-tagged CYB-1-GST. The GST gene was amplified from pDEST15 (Invitrogen, 11802-014) and inserted into pET-28a(+) (Novagen, 69864-3) to generate pYS1. The same N-terminal portion of CYB-1 used to produce the CYB-1-MBP-6xHis fusion protein was cloned into the pYS1 vector. cyb-1