WormBase Tree Display for Variation: WBVar00142935

WBVar00142935 Name: Public_name: e51
    Other_name (18)
    HGVSg: CHROMOSOME_I:g.7434408C>T
  Sequence_details: SMap: S_parent: Sequence: C44E1
    Flanking_sequences: AAGATGACACTCACCAATATGATGAAGTTGATCGTGGATCC GAGTATCTTTCACAAGAACACCATCAGTAGATAGAACAG
    Mapping_target: C44E1
    Type_of_mutation: Substitution: C T Person_evidence: WBPerson26471
    SeqStatus: Sequenced
  Variation_type: Engineered_allele
  Origin: Species: Caenorhabditis elegans
    Strain (64)
    Laboratory: CB
      KR
      NCA
    Person: WBPerson26471
    Status: Live
  Linked_to: WBVar02146566
  Affects: Gene: WBGene00006752
    Transcript: ZK524.2e.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: ZK524.2e.1:c.1411C>T
        HGVSp: CE34626:p.Arg471Ter
        cDNA_position: 1411
        CDS_position: 1411
        Protein_position: 471
        Exon_number: 11/30
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
      ZK524.2c.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: ZK524.2c.1:c.388C>T
        HGVSp: CE34624:p.Arg130Ter
        cDNA_position: 388
        CDS_position: 388
        Protein_position: 130
        Exon_number: 3/22
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
      ZK524.2f.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: ZK524.2f.1:c.1420C>T
        HGVSp: CE43866:p.Arg474Ter
        cDNA_position: 1420
        CDS_position: 1420
        Protein_position: 474
        Exon_number: 11/30
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
      ZK524.2j.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: ZK524.2j.1:c.1375C>T
        HGVSp: CE51718:p.Arg459Ter
        cDNA_position: 1375
        CDS_position: 1375
        Protein_position: 459
        Exon_number: 11/29
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
      ZK524.2k.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: ZK524.2k.1:c.1366C>T
        HGVSp: CE51726:p.Arg456Ter
        cDNA_position: 1366
        CDS_position: 1366
        Protein_position: 456
        Exon_number: 11/29
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
      ZK524.2a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: ZK524.2a.1:c.1411C>T
        HGVSp: CE15371:p.Arg471Ter
        cDNA_position: 1411
        CDS_position: 1411
        Protein_position: 471
        Exon_number: 11/30
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
      ZK524.2i.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: ZK524.2i.1:c.1420C>T
        HGVSp: CE32552:p.Arg474Ter
        cDNA_position: 1420
        CDS_position: 1420
        Protein_position: 474
        Exon_number: 11/29
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
      ZK524.2d.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: ZK524.2d.1:c.1411C>T
        HGVSp: CE34625:p.Arg471Ter
        cDNA_position: 1411
        CDS_position: 1411
        Protein_position: 471
        Exon_number: 11/31
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
      ZK524.2h.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: ZK524.2h.1:c.388C>T
        HGVSp: CE51759:p.Arg130Ter
        cDNA_position: 388
        CDS_position: 388
        Protein_position: 130
        Exon_number: 3/21
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
    Interactor: WBInteraction000518950
  Isolation: Mutagen: EMS
  Genetics: Interpolated_map_position: I 2.07389
    Mapping_data: In_2_point (20)
      In_multi_point (87)
      In_pos_neg_data: 466
        470
        2514
        5851
        5853
        5963
        8066
        8086
  Description: Phenotype (13)
    Phenotype_not_observed: WBPhenotype:0000640 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: able to lay eggs Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0001426 Paper_evidence: WBPaper00030754
          WBPaper00004883
        Curator_confirmed: WBPerson712
        Remark: as measured by fluorescence levels of ANF::GFP in coelomocytes Paper_evidence: WBPaper00030754
            Curator_confirmed: WBPerson712
        Variation_effect: Hypomorph_reduction_of_function: Paper_evidence: WBPaper00004883
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: EG3683 unc-13(e51) oxIs206[Paex-3:ANF::GFP] Paper_evidence: WBPaper00030754
              Curator_confirmed: WBPerson712
            arIs37 Paper_evidence: WBPaper00004883
              Curator_confirmed: WBPerson712
      WBPhenotype:0001512 Paper_evidence: WBPaper00031992
        Curator_confirmed: WBPerson712
        Remark: ON-OFF asymmetry of ASEL and ASER was preserved in each of these animals. Paper_evidence: WBPaper00031992
            Curator_confirmed: WBPerson712
      WBPhenotype:0001645 Paper_evidence: WBPaper00040284
        Curator_confirmed: WBPerson2987
        Remark: Table S2 Paper_evidence: WBPaper00040284
            Curator_confirmed: WBPerson2987
  Reference (29)
  Remark: Old Mapping_target ZK524 updated based on the VEP analysis pipeline to C44E1.
    Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006752 Opal_UGA R to STOP Person_evidence: WBPerson26471"
        WBPerson26471
  Method: Substitution_allele