WormBase Tree Display for Variation: WBVar00142953

WBVar00142953 Evidence: Paper_evidence: WBPaper00001618
  Name: Public_name: e88
    Other_name: CE04580:p.Gly156Arg
      F46C8.6.1:c.466G>A
    HGVSg: CHROMOSOME_X:g.7537144C>T
  Sequence_details: SMap: S_parent: Sequence: F46C8
    Flanking_sequences: gctggcccaccaggaactcgaggaccacag gagaagttggacgtccaggacagactggtg
    Mapping_target: F46C8
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00001618
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004095
      WBStrain00023947
      WBStrain00026736
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00001069
    Transcript: F46C8.6.1 (12)
    Interactor: WBInteraction000052373
      WBInteraction000519116
      WBInteraction000519123
      WBInteraction000537304
      WBInteraction000571286
      WBInteraction000571288
      WBInteraction000571291
      WBInteraction000571292
      WBInteraction000571572
  Isolation: Mutagen: EMS Paper_evidence: WBPaper00001618
  Genetics: Interpolated_map_position: X -1.6004
    Mapping_data: In_2_point (14)
      In_multi_point (28)
      In_pos_neg_data (17)
  Description: Phenotype (18)
    Phenotype_not_observed: WBPhenotype:0000505 Paper_evidence: WBPaper00001328
        Curator_confirmed: WBPerson712
        Remark: Males are not Ram. Paper_evidence: WBPaper00001328
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0006941 PATO:0000460 Paper_evidence: WBPaper00001328
                Curator_confirmed: WBPerson712
          Life_stage: WBls:0000056 PATO:0000460 Paper_evidence: WBPaper00001328
                Curator_confirmed: WBPerson712
        Phenotype_assay: Temperature: 20C Paper_evidence: WBPaper00001328
              Curator_confirmed: WBPerson712
          Genotype: him-5(e1490) Paper_evidence: WBPaper00001328
              Curator_confirmed: WBPerson712
      WBPhenotype:0000645 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: non-roller Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0001182 Paper_evidence: WBPaper00032396
        Curator_confirmed: WBPerson2987
        Remark: dpy-7(e88) did not affect the lipid depleted phenotype of daf-2(e1370);aak-2(ok524) double mutant dauers (Figure 2h) Paper_evidence: WBPaper00032396
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: Dauer larva were stained with Sudan Black to visualize lipid content Paper_evidence: WBPaper00032396
              Curator_confirmed: WBPerson2987
          Genotype: daf-2(e1370);aak-2(ok524) Paper_evidence: WBPaper00032396
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001412 Paper_evidence: WBPaper00005747
        Curator_confirmed: WBPerson2987
        Remark: Table 1 Paper_evidence: WBPaper00005747
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: kaIs12 [col-19::gfp] Paper_evidence: WBPaper00005747
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001426 Paper_evidence: WBPaper00004883
        Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: arIs37 Paper_evidence: WBPaper00004883
              Curator_confirmed: WBPerson712
      WBPhenotype:0001732 Paper_evidence: WBPaper00032033
        Curator_confirmed: WBPerson712
        Remark: Animals exhibited the same pH survival profile as the wild-type strain over a range of pH 3 to pH 10. Paper_evidence: WBPaper00032033
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Mixed or synchronised populations of nematodes were exposed to 500ul M9 buffer (100 mM phosphate, 85 mM NaCl, 1 mM MgSO4 buffered at the appropriate pH by varying KH2PO4 and Na2HPO4 concentrations accordingly) at varying pHs in a 24-well plate format for 4 h (200 nematodes/well). Nematodes were scored as viable by the presence of touch response and pharyngeal pumping. Paper_evidence: WBPaper00032033
              Curator_confirmed: WBPerson712
  Disease_info: Models_disease: DOID:37
    Models_disease_in_annotation: WBDOannot00001175
  Reference (15)
  Remark: Variation stub/paper connection generated from the May 2021 NN VFP dataset.
    Created by WBPerson51134 from the NN_VFP_triage_pipeline
  Method: Substitution_allele