WormBase Tree Display for Variation: WBVar00142989
expand all nodes | collapse all nodes | view schema
| WBVar00142989 | Evidence | Person_evidence | WBPerson11112 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e138 | |||||
| Other_name | e138am | ||||||
| F57H12.2.1:c.445C>T | |||||||
| CE52881:p.Gln149Ter | |||||||
| HGVSg | CHROMOSOME_IV:g.7980970C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | F57H12 | |||
| Flanking_sequences | aaattggtagttttacgcctgggaagagct | agaagacaagaggacctggtataactttag | |||||
| Mapping_target | F57H12 | ||||||
| Type_of_mutation | Substitution | c | t | ||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain (89) | |||||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006761 | |||||
| Transcript | F57H12.2.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F57H12.2.1:c.445C>T | ||||||
| HGVSp | CE52881:p.Gln149Ter | ||||||
| cDNA_position | 458 | ||||||
| CDS_position | 445 | ||||||
| Protein_position | 149 | ||||||
| Exon_number | 5/8 | ||||||
| Codon_change | Cag/Tag | ||||||
| Amino_acid_change | Q/* | ||||||
| Interactor | WBInteraction000500601 | ||||||
| WBInteraction000519108 | |||||||
| WBInteraction000519121 | |||||||
| WBInteraction000524784 | |||||||
| WBInteraction000556982 | |||||||
| WBInteraction000556983 | |||||||
| WBInteraction000556984 | |||||||
| WBInteraction000556985 | |||||||
| Genetics | Interpolated_map_position | IV | 3.51487 | ||||
| Mapping_data | In_2_point (21) | ||||||
| In_multi_point (105) | |||||||
| In_pos_neg_data | 960 | ||||||
| 966 | |||||||
| 2735 | |||||||
| 3702 | |||||||
| Description | Phenotype | WBPhenotype:0000002 | Person_evidence | WBPerson261 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | weak kinker, severe kinker in L1 | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000353 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | tends to back | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000551 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | often forms omega shape | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||
| Curator_confirmed | WBPerson48 | ||||||
| Phenotype_not_observed | WBPhenotype:0000032 | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | fairly active; healthy | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||
| Curator_confirmed | WBPerson2987 | ||||||
| Remark | Table 1 | Paper_evidence | WBPaper00040284 | ||||
| Curator_confirmed | WBPerson2987 | ||||||
| Reference | WBPaper00040284 | ||||||
| WBPaper00014528 | |||||||
| WBPaper00000031 | |||||||
| WBPaper00013927 | |||||||
| WBPaper00013987 | |||||||
| WBPaper00015247 | |||||||
| WBPaper00013817 | |||||||
| WBPaper00013879 | |||||||
| WBPaper00061173 | |||||||
| WBPaper00065317 | |||||||
| Remark | Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||
| Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
| Method | Substitution_allele |
