WormBase Tree Display for Variation: WBVar00143023
expand all nodes | collapse all nodes | view schema
WBVar00143023 | Evidence | Person_evidence | WBPerson499 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e189 | ||||||
Other_name | ZK637.8a.1:c.614+288G>A | |||||||
ZK637.8e.1:c.460-345G>A | ||||||||
ZK637.8f.1:c.460-1G>A | ||||||||
ZK637.8c.1:c.460-345G>A | ||||||||
ZK637.8b.1:c.460-1G>A | ||||||||
ZK637.8d.1:c.614+288G>A | ||||||||
HGVSg | CHROMOSOME_III:g.8906966G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK637 | ||||
Flanking_sequences | taaaatctccttcactaacaca | gccgggactggagaaatgttgcca | ||||||
Mapping_target | ZK637 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (303) | ||||||||
Laboratory | CB | |||||||
OJ | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006768 | ||||||
Transcript | ZK637.8c.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | ZK637.8c.1:c.460-345G>A | |||||||
Intron_number | 4/11 | |||||||
ZK637.8f.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK637.8f.1:c.460-1G>A | |||||||
Intron_number | 4/11 | |||||||
ZK637.8e.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | ZK637.8e.1:c.460-345G>A | |||||||
Intron_number | 4/11 | |||||||
ZK637.8d.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | ZK637.8d.1:c.614+288G>A | |||||||
Intron_number | 5/11 | |||||||
ZK637.8b.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK637.8b.1:c.460-1G>A | |||||||
Intron_number | 4/11 | |||||||
ZK637.8a.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | ZK637.8a.1:c.614+288G>A | |||||||
Intron_number | 5/11 | |||||||
Interactor | WBInteraction000524785 | |||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | III | -0.00184685 | |||||
Mapping_data | In_2_point (31) | |||||||
In_multi_point (171) | ||||||||
In_pos_neg_data | 806 | |||||||
3726 | ||||||||
Description | Phenotype (26) | |||||||
Phenotype_not_observed | WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table 1 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Reference (32) | ||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Method | Substitution_allele |