WormBase Tree Display for Variation: WBVar00143072
expand all nodes | collapse all nodes | view schema
WBVar00143072 | Name | Public_name | e264 | ||||
---|---|---|---|---|---|---|---|
Other_name | CE24908:p.Trp5Ter | ||||||
F21F3.5.1:c.15G>A | |||||||
HGVSg | CHROMOSOME_I:g.4900886C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | F21F3 | |||
Flanking_sequences | aatacttaaaaaaaagatgcgctctttttg | ttattccttttactgttattattttgcatc | |||||
Mapping_target | F21F3 | ||||||
Type_of_mutation | Substitution | g | a | Person_evidence | WBPerson22169 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004213 | ||||||
WBStrain00030692 | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006774 | |||||
Transcript | F21F3.5.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | F21F3.5.1:c.15G>A | ||||||
HGVSp | CE24908:p.Trp5Ter | ||||||
cDNA_position | 89 | ||||||
CDS_position | 15 | ||||||
Protein_position | 5 | ||||||
Exon_number | 2/10 | ||||||
Codon_change | tgG/tgA | ||||||
Amino_acid_change | W/* | ||||||
Isolation | Reverse_genetics | PCR | |||||
Genetics | Interpolated_map_position | I | -0.647852 | ||||
Mapping_data | In_multi_point | 969 | |||||
1787 | |||||||
1788 | |||||||
2092 | |||||||
In_pos_neg_data | 332 | ||||||
Description | Phenotype (31) | ||||||
Phenotype_not_observed | WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0001853 | Paper_evidence | WBPaper00035150 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Mutant response to AAD 1470 was comparable to that observed in wild-type | Paper_evidence | WBPaper00035150 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00040284 | ||||||
WBPaper00041069 | |||||||
WBPaper00041959 | |||||||
WBPaper00043908 | |||||||
WBPaper00029130 | |||||||
WBPaper00035074 | |||||||
WBPaper00000031 | |||||||
WBPaper00004117 | |||||||
WBPaper00035150 | |||||||
WBPaper00000484 | |||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006774 Opal_UGA W(5) to stop | ||||||
Method | Substitution_allele |