WormBase Tree Display for Variation: WBVar00143072
expand all nodes | collapse all nodes | view schema
| WBVar00143072 | Name | Public_name | e264 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | CE24908:p.Trp5Ter | ||||||
| F21F3.5.1:c.15G>A | |||||||
| HGVSg | CHROMOSOME_I:g.4900886C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | F21F3 | |||
| Flanking_sequences | aatacttaaaaaaaagatgcgctctttttg | ttattccttttactgttattattttgcatc | |||||
| Mapping_target | F21F3 | ||||||
| Type_of_mutation | Substitution | g | a | Person_evidence | WBPerson22169 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00004213 | ||||||
| WBStrain00030692 | |||||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006774 | |||||
| Transcript | F21F3.5.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F21F3.5.1:c.15G>A | ||||||
| HGVSp | CE24908:p.Trp5Ter | ||||||
| cDNA_position | 89 | ||||||
| CDS_position | 15 | ||||||
| Protein_position | 5 | ||||||
| Exon_number | 2/10 | ||||||
| Codon_change | tgG/tgA | ||||||
| Amino_acid_change | W/* | ||||||
| Isolation | Reverse_genetics | PCR | |||||
| Genetics | Interpolated_map_position | I | -0.647852 | ||||
| Mapping_data | In_multi_point | 969 | |||||
| 1787 | |||||||
| 1788 | |||||||
| 2092 | |||||||
| In_pos_neg_data | 332 | ||||||
| Description | Phenotype (31) | ||||||
| Phenotype_not_observed | WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||
| Curator_confirmed | WBPerson2987 | ||||||
| Remark | Table S2 | Paper_evidence | WBPaper00040284 | ||||
| Curator_confirmed | WBPerson2987 | ||||||
| WBPhenotype:0001853 | Paper_evidence | WBPaper00035150 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | Mutant response to AAD 1470 was comparable to that observed in wild-type | Paper_evidence | WBPaper00035150 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Reference | WBPaper00040284 | ||||||
| WBPaper00041069 | |||||||
| WBPaper00041959 | |||||||
| WBPaper00043908 | |||||||
| WBPaper00029130 | |||||||
| WBPaper00035074 | |||||||
| WBPaper00000031 | |||||||
| WBPaper00004117 | |||||||
| WBPaper00035150 | |||||||
| WBPaper00000484 | |||||||
| Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006774 Opal_UGA W(5) to stop | ||||||
| Method | Substitution_allele |
