WormBase Tree Display for Variation: WBVar00143164
expand all nodes | collapse all nodes | view schema
| WBVar00143164 | Evidence | Paper_evidence | WBPaper00003576 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e382 | |||||||
| Other_name (13) | |||||||||
| HGVSg | CHROMOSOME_III:g.10527973G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | T21C12 | |||||
| Flanking_sequences | ttgagaacggagacaccgattttgcagacg | gtacgagacgaaagatatcgactactattg | |||||||
| Mapping_target | T21C12 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003576 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004157 | ||||||||
| WBStrain00027163 | |||||||||
| WBStrain00027198 | |||||||||
| WBStrain00027239 | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00006784 | |||||||
| Transcript | T21C12.1k.1 (12) | ||||||||
| T21C12.1m.1 (12) | |||||||||
| T21C12.1c.1 (12) | |||||||||
| T21C12.1e.1 (12) | |||||||||
| T21C12.1c.2 (12) | |||||||||
| T21C12.1o.1 | VEP_consequence | intron_variant | |||||||
| VEP_impact | MODIFIER | ||||||||
| HGVSc | T21C12.1o.1:c.59-2613G>A | ||||||||
| Intron_number | 1/5 | ||||||||
| T21C12.1d.1 (12) | |||||||||
| T21C12.1f.1 | VEP_consequence | intron_variant | |||||||
| VEP_impact | MODIFIER | ||||||||
| HGVSc | T21C12.1f.1:c.563-2613G>A | ||||||||
| Intron_number | 6/11 | ||||||||
| Interactor | WBInteraction000517364 | ||||||||
| WBInteraction000562870 | |||||||||
| Genetics | Interpolated_map_position | III | 3.36713 | ||||||
| Mapping_data | In_2_point | 73 | |||||||
| 3249 | |||||||||
| In_multi_point (51) | |||||||||
| In_pos_neg_data | 3242 | ||||||||
| 3250 | |||||||||
| 3251 | |||||||||
| Description | Phenotype (13) | ||||||||
| Phenotype_not_observed | WBPhenotype:0001232 | Paper_evidence | WBPaper00001861 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Male tail curling in response to serotonin is similar to WT. | Paper_evidence | WBPaper00001861 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Affected_by | Molecule | WBMol:00004929 | Paper_evidence | WBPaper00001861 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001861 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00038249 | ||||||||
| WBPaper00041069 | |||||||||
| WBPaper00000031 | |||||||||
| WBPaper00010938 | |||||||||
| WBPaper00022718 | |||||||||
| WBPaper00035082 | |||||||||
| WBPaper00001861 | |||||||||
| WBPaper00003576 | |||||||||
| WBPaper00042154 | |||||||||
| WBPaper00045634 | |||||||||
| Remark | affects UNC-49B subunit only | ||||||||
| Method | Substitution_allele |
