Mapped Transgenes

From WormBaseWiki

WormBase Release WS195

408 integrated transgenes with map information found (download Excel file)

Transgene	Transgene_summary	Reporter	Strain	Map_position	Expression_pattern	Gene	Anatomy_term	Life_stage	Reference
WBPaper00005807Is1	[sur-5::gfp]	GFP	CU217	I
akIs7	[nmr-1::gfp]	GFP		V
akIs9	[glr-1::GLR-1(A/T)]			X
arIs100	[dpy-7::2Xnls-yfp]	YFP		II
arIs12	[lin-12(intra)]. Expresses the intracellular domain of LIN-12 under the control of lin-12 promoter. Marked with rol-6(su1006).			I
arIs37	[pmyo-3::ssGFP]	GFP	GS1912 GS2477 GS2478 GS2479 GS2484 GS2495 GS2526 GS2527 GS2532 GS2555 GS2643 LW557 LW614 LW1288 GS1919	I
arIs39	[myo-3::secreted gfp]	GFP	PD3011 GS2077	X
arIs51	[cdh-3::gfp]	GFP	GS3754	IV
arIs99	[dpy-7p::2Xnls::yfp]	YFP		X
axIs36	[pes-10::gfp]	GFP	JH103	X
ayIs2	[egl-15::gfp]	GFP	NH2447 PD4285	IV
ayIs26	[Phsp16-2::let-756 (50 ng/ul); Pmyo-2::GFP (5 ng/ul)]	GFP		III
ayIs29	[egl-15(+) (5 ng/ul); Pmyo-2::GFP (5 ng/ul); pGEM5Z (70 ng/ul)]	GFP		IV	Expr8096	egl-15	hypodermis		WBPaper00031854
ayIs4	[egl-17::gfp]. Integrated transgenic line of full length EGL-17 cDNA with GFP at its C term.	GFP	NH2246 NH2466 PS2580 PS2674 PS2987 PS3082 PS5106 PS5423	I:-16	Expr630	egl-17	proct PChL proct PChR spicule socket cell	L3 larva L4 larva adult	WBPaper00003579
ayIs4	[egl-17::gfp]. Integrated transgenic line of full length EGL-17 cDNA with GFP at its C term.	GFP	NH2246 NH2466 PS2580 PS2674 PS2987 PS3082 PS5106 PS5423	I:-16	Expr1434	egl-17	P6.ppp P6.paa hyp7 P7.ppa vulB2 P5.ppa P7.pp P6.pa vulE hyp7 P3.p P7.ppp P6.ppa vulB1 P5.pap P5.paa P6.pp hyp7 hyp7 P6.pap P7.p hypodermis P4.p P5.pp head M4 P7.pa P6.p P5.p vulF vulval cell vulC P8.p P5.pa vulval cell hyp7 P7.pap vulA vulD hyp7	3-fold embryo fully-elongated embryo postembryonic	WBPaper00003045
ayIs4	[egl-17::gfp]. Integrated transgenic line of full length EGL-17 cDNA with GFP at its C term.	GFP	NH2246 NH2466 PS2580 PS2674 PS2987 PS3082 PS5106 PS5423	I:-16	Expr2354	egl-17	vulE vulF vulC vulD	L3 larva L4 larva	WBPaper00013312
ayIs6	[hlh-8::gfp]	GFP	PD4666	X	Expr8096	egl-15	hypodermis		WBPaper00031854
ayIs7	[hlh-8::gfp]	GFP	PD4667 RG174	IV	Marker68	hlh-8	M		WBPaper00032077
ayIs9	[egl-17::gfp]	GFP	NH646	V	Expr1814	egl-17	dorsal uterine cell	L4 larva adult	WBPaper00004362
bIs1	[vit-2::gfp; rol-6(su1006)]. The plasmid V2B3 encodes a functional VIT-2(YP170B)::GFP fusion protein expressed under vit-2 promoter control. The plasmid was made by ligating a PCR product encoding vit-2 genomic sequences, including 1 kb of promoter and the complete gene lacking a stop codon, into the GFP plasmid pPD95.85, cut with XmaI and KpnI. The vit-2 gene was PCR amplified with primers V2F (TCCCCCCGGGTCCACGGACATTTCTGGGTCATTTG) and V2R (CGGGGTACCAGATAAGCGACGCAGGCGGTTGGGAC), containing engineered XmaI and KpnI sites, using cosmid DNA (C42D8) as a template. V2B3, at 50 ug/ml, was coinjected with rol-6(d) marker pRF4, at 100 ug/ml, into N2 to make transformed lines using standard methods. Four integrated lines (bIs1bIs4) were produced by standard methods.	GFP	DH1033 DH1006	X
bcIs1	[egl-1::gfp]	GFP		III
bcIs24	[tph-1::gfp]	GFP		X
bcIs25	[tph-1::gfp]	GFP		IV
bcIs30	[tph-1::gfp]	GFP		X
bcIs37	[egl-1::his24-gfp]	GFP		V
bcIs39	[lim-7::ced-1-gfp]	GFP	MD701	V
bnIs1	[pie-1::gfp-pgl-1, unc-119(+)]. Constructed by amplification of a 2.2 kb segment of pgl-1 cDNA with the primers 5'-GGACTAGTATGGAGGCTAACAAGCG-3' and 5'-CCACTAGTTTAGAAACCTCCGCGTCC-3', digestion of the PCR product and the plasmid pAZ132 with SpeI, ligation of the pgl-1 product and the SpeI fragment of pAZ132 bearing unc-119(+) and pie-1::gfp sequences, and bombardment of the ligated DNA into unc-119(ed3) worms.	GFP	SS747 SS629	I
bpIs56	[alg-1::dsRed]	DsRed		II
bxIs13	[egl-5::gfp, lin-15]	GFP	EM599 HZ107 HZ113	X
bxIs14	[pkd-2::gfp, pha-1]	GFP	EM886 EM902 EM905 EM907 EM908 EM909 EM911	V
bxIs16	[tph-1::gfp (EM#310), cat-2::yfp (EM#303), pBX-1]	GFP	HZ66 HZ67	V
bzIs3	[mec-4::lacZ]. Contains ~10 copies of mec-4(u231) allele and several copies of mec-4::lacZ fusion TU#44.	LacZ	ZB7	X
bzIs67	[mec-10::mec-10(d)-GFP pRF4]	GFP	ZB2356	X
bzIs7	[mec-4::gfp]	GFP	ZB171	IV
bzIs75	[mec-4::mec-10(d)-GFP unc-119(+)]	GFP	ZB2374	IV
ccIs4251	[myo-3::Ngfp-lacZ; myo-3::Mtgfp]	GFP	CB5600 HC75 HC114 HC271 PD4251 PD6249	I:4	Marker38	myo-3	muscle cell		WBPaper00031556
ccIs4438	[hlh-8::gfp]	GFP		IV
ccIs4439	[intrinsic CC::gfp]	GFP	PD4439	III
ccIs4443	[arg-1::gfp]	GFP	PD4443	IV
ccIs4444	[arg-1::gfp; dpy-20(+)]	GFP	PD4444	II	Expr4734	arg-1	vulval muscle anal depressor muscle hmc intestinal muscle anal sphincter muscle		WBPaper00029191
ccIs4595	[ceh-24::gfp]	GFP	PD4595	V
ccIs4636	[hlh-8::lacZ]	LacZ	PD4636	V
ccIs4655	[Nde-box::gfp]	GFP	PD4655	II
ccIs4656	[NdE-box::gfp]	GFP	PD4656	IV
ccIs4810	[lmn-1::gfp]. A fusion of GFP to the C-terminus of Ce-lamin.	GFP	YG1021 LW0697	X	Expr956	lmn-1	Cell	all stages	WBPaper00004416
ccIs4810	[lmn-1::gfp]. A fusion of GFP to the C-terminus of Ce-lamin.	GFP	YG1021 LW0697	X	Marker9	lmn-1			WBPaper00026936
ccIs4811	[lmn-1::lmn-1-gfp-lmn-1 3UTR; pMH86(dpy-20(+)]	GFP	LW0698	X	Marker9	lmn-1			WBPaper00026936
ccIs4812	[lmn-1::lmn-1-gfp-lmn-1 3UTR; pMH86(dpy-20(+)]	GFP	LW0700	X	Marker9	lmn-1			WBPaper00026936
ccIs55	[sup-7(st5)unc-54::LacZ]	LacZ	PD55 PJ1002 PJ1015 PJ1034 PJ1036 PJ1039 PJ1044 PJ1046 PJ1062 PJ1063 PJ1065 PJ1069 PJ1070 PJ1076 PJ1078 PJ1080 PJ1085 PJ1092 PJ1093 PJ1099 PJ1100 PJ1105 PJ1107 PJ1109 PJ1110 PJ1114 PJ1115 PJ1121 PJ1124 PJ1126 PJ1132 PJ1134 PJ1145 PJ1146 PJ1153 PJ1154 PJ1155 PJ1156 PJ1158 PJ1162 PJ1166	V
ccIs7963	[hlh-1::gfp]	GFP		V
ccIs9753			PD9753	I:27.5
cdIs5	[myo-3::DsRed2]	DsRed2		I
cgc3903Is1	[tph-1::gfp]. A DNA fragment encompassing the 3.1 kb tph-1 5' regulatory sequence and introns and exons to the beginning of exon 4, was PCR amplied using primers containing restriction sites, ligated to the GFP cassette pPD95.75.	GFP	GR1333	V	Expr959	tph-1	HSNR ADFR NSMR AIML NSML AIMR CP neuron RIH ADFL HSNL	L1 larva adult	WBPaper00003903
cgc5080Is2	[rgs-2::gfp]	GFP	LX354	IV
cgc5924Is1	[tph-1::gfp; rol-6(su1006)]	GFP		V
cgc6572Is1	[pie-1::gfp-spd-2] translational fusion.	GFP	TH42	II	Expr2995	spd-2			WBPaper00013494
cgc6998Is1	[kin-29::gfp]	GFP	PY3018	IV
cgc7137Is1	[elt-2::gfp-LacZ]	GFP		X
chIs1200	[ceh-26::gfp] translational fusion.	GFP	TB1225	III	Expr2696	ceh-26	HOB	L4 larva adult male	WBPaper00006247
cmIs6	[mbk-1::gfp] translational fusion. The mbk-1 genomic locus, including 7 kb of 5' noncoding sequence and all exons and introns, was amplified by Expand long-template PCR. The PCR product was cloned in frame with gfp in the promoterless vector pPD95.75, generating pBR104.	GFP	EK224	I	Expr2387	mbk-1	Cell	gastrulating embryo enclosing embryo elongating embryo fully-elongated embryo L1 larva L2 larva L3 larva L4 larva adult	WBPaper00005756
ctIs1	[her-1::lacZ]. The construct is also known as P2::lacZ. P2 refers to the 3.4 kb of DNA upstream of her-1 exon-3.	LacZ		I
ctIs32	[her-1::gfp]. The construct is also known as P2::gfp. P2 refers to the 3.4 kb of DNA upstream of her-1 exon-3.	GFP
ctIs40	[ZC421(+); sur-5::gfp]. Overexprss cosmid ZC421 which contains gene dbl-1. sur-5::gfp is used as injection marker.	GFP	BW1940	X
ctIs43	[unc-119(+); dbl-1::gfp+NLS; dbl-1::gfp-NLS]	GFP	BW1935 BW1946	V	Expr626	dbl-1	VB10 M1 M5 VB7 CANL VA8 DB5 VA12 VB9 DA5 VB8 AVKL VB3 VA6 SPso3L DB7 DVA DB6 SPso2R DB4 I5 VB5 VA4 pm2R VB11 VA10 VB6 VA7 VA11 SPso3R DB2 DA6 M4 SPso2L DA7 CANR SPso4L SPso1R VA5 AVKR VB1 VA2 pm2L pharyngeal neuron ventral nerve cord DB1 DA4 VB2 dorsal nerve cord DB3 SPso1L VA9 DA3 SPso4R VB4 PDB	embryo L1 larva L2 larva L3 larva L4 larva adult	WBPaper00003401
cuIs2	[myo-2 C183::gfp]. Integrated expression line for myo-2 enhancer C subelement C183::gfp.	GFP	OK39 OK66 OK68 OK0039	IV
cuIs22	[ceh-22::gfp]	GFP	OK0507	III
cuIs5	[myo-2 C183::gfp]. Integrated expression line for myo-2 enhancer C subelement C183::gfp.	GFP		I
dhIs26	[daf-12A::gfp; lin15(+)]	GFP	AA120	I
dtIs372	[his-24::his-24-gfp]	GFP		X
dvIs19	[K08F4.7(727bp):GFP-NLS]	GFP	CL2166	III	Expr8083	gst-4	body wall musculature		WBPaper00031223
eIs24	[vab-7::lacZ]	LacZ		II	Expr93	vab-7	Capp Cppp Caap Cpap	embryo L1 larva	WBPaper00002462
eIs25	[fox-1(gf); rol-6(su1006)]. Contains extrachromosomal copies of R04B3, a cosmid containing fox-1 genomic region.			V
eIs26	[fox-1(gf); rol-6(su1006)]. Contains extrachromosomal copies of R04B3, a cosmid containing fox-1 genomic region.			IV
eIs27	[fox-1(gf); rol-6(su1006)]. Contains extrachromosomal copies of R04B3, a cosmid containing fox-1 genomic region.			V
[unc-31::lacZ;class=Transgene eIs[unc-31::lacZ]]	[unc-31::lacZ], in-frame fusion, consists of 15 kb 5' upstream sequence and most of the coding regions of unc-31.	LacZ		V
edIs6	[unc-119::gfp]	GFP	DP132	IV	Marker39	unc-119	neuron		WBPaper00031556
enIs18	[lim-7::mfg-e8-gfp]	GFP		X
enIs2		GFP		X
enIs7	[ced-1::ced-1-GFP; unc-76(+)]	GFP		X	Marker40	ced-1	engulfing cell		WBPaper00031556
etIs1	[ric-19::gfp]	GFP	QC5	IV
etIs2	[ric-19::gfp]	GFP	QC47 QC101 QC102 QC103 QC104 QC105	III
evIs130A	[mec-7::UNC-40-GFP]	GFP	NW1509	II
evIs138	[plx-2(+); sur-5::gfp]	GFP	NW1696	V
evIs54	[unc-5B::lacZ]	LacZ		II
evIs98	[unc-5::GFP; dpy-20(+)]	GFP		V
evIs99	[emb-9::unc-5; emb-9::lacZ; dpy-20(+)]	LacZ		I
ezIs1	[K09C8.2::gfp, pRF4]	GFP	DZ224	X
ezIs10	[lin-32::gfp]	GFP	DZ390	II
ezIs2	[fkh-6(pro)::gfp, unc-119(+)] transcriptional fusion.	GFP	DZ325	III	Expr2972	fkh-6	gonad spermatheca Z1 Z4	L1 larva L2 larva L3 larva L4 larva adult	WBPaper00006485
gaIs27	[let-23::gfp; rol-6(su1006d)]	GFP		I
gaIs36	[hs-mpk-1(+); EF1alpha-D-mek(gf); unc-30(+)]			V
gmIs12	[srb-6::gfp]	GFP		III	Expr3411	srb-6	PHBL PHBR PHAL PHAR		WBPaper00026633
gmIs13	[srb-6::gfp; rol-6]	GFP		II
gmIs18	[ceh-23::gfp]	GFP		X
gmIs20	[hlh-14::gfp] translational fusion.	GFP		II	Expr2897	hlh-14	ABplapppapp Caapa ABprapppapa ABprapppaa ABprapppa ABplapppa ABprapppap PVQL ABprapppaap ABprapppapp ABplapppap ABplapppaa ABplapppaap PVQR ABplapppapa	proliferating embryo	WBPaper00006354
gmIs21	[nlp-1::gfp]	GFP		II
gmIs22	[nlp-1::gfp]	GFP		V
gmIs5	[ina-1::gfp], the ina-1-GFP fusion construct extended from a SmaI site (31302) to a SphI site (16376) surrounding the ina-1 coding region (2354519169), and preserved all introns of the gene.	GFP	NG2517	III	Expr1998	ina-1	pm4VR ABplppppap ABprapappppp ABaraaaap ABarapapaaa V3L Capaapp ABarappppa Cppppaa ABalpappp ABalpaap ABplapapaa Dpaaa Dppp ILsoDR MSpappppp mc1DR ABarppapa MSpaapaap Cappaa ABprpaapa URYDL g2R MSapppap ABplppp DA6 MSaaappa ABarpppa ABarpapapa ABplapapppa Caappd MSpaaaaap MSaapap ABalppaaa ILsoDL