CJA01181unspliced + UTR.fasta
>CJA01181 unspliced + UTR ATGGGTGAGTCGCGAACCATATCCGGACACGAATTTGCAATACGGAAGCTTCAAGACACGGTGAAAGTGATTTGCAAAGA GTTCGGGTTCACATCGGTATCGCCGGCGGTCATCAACAAATTGGCAGCGATTTTGAGGAGCAAGCTGTGCGAGTTTGGCC AGACAACACGGGTTTTTATGGAGCATAgtgagtttttaaacattttaatgtttcttttggggctaaaaattaatattact tattctcatggtgcgagaccacatggtcgcggccgcgaaatggcgcgtggccgactgactgcaaatattgcggaaacaaa aaattacaatgcggtgcttgcgtactttgaaaattcaaacagtaatgaaagcaatgtcttaccaaacgaaaagaaatgct cccattgtcgtttgaatttcaaaattacgaaaaaaaaccgcgttgcaatttgtttttttcataataataataattcaatt tcagCGGGTCGAACACAAGCAATAATCGGTGATGTATTGGCGGCGTTAAAATACAAAAATGTGAGCATATCAGAAATACG AGACTATGGTAATCAAGTGTCTTGCGAGCGGATGAATGCGgtgagtttttgtttaaaacgttttttttaaagaatgtgag acatcgttgcttttttatatgaataaaatccatacaataattccgacgctattgtcggcccgccaaatttcacgtataaa ttcaacgtggaatgaaataatttggaaagcaaaacgaaaatcacatagcgttgagttcagcggagcgcgtttgaccattt tggcggtacgacaatagttaaaaagttaaatagtctaatttgaggcgaattttggcccaaaaagtgcatgtcgatatcgt tgcagcgacaaatttcaccaaaaatttactttccagCTTCCTATCTTCCCGGTGCCAAATCAAGAAACAGAAAAGTCTCC GGACGCATTTTTCCTAGCAATGTACGGTCCAAAACCGTCAGAACGAGAGCTCGCCGAGCGGCCCGAGCAAATCCCTCCAC ATTTTCGAGCCCTGCACCCTGAATGGATCGACGAGGAAAACAAAGCTGAAACGACCGCCGACCCAAATCTCAATCAAAAC CCAAAAGAAGCAAAGCGGGCAGCCAAAAATGCTGCAGATCGAGAGCAAGATGAGTTTAACAAGTTGAAAAGGATAAACAC TTATCGACGGAATGAAACTCCAGAAGCGCAAAAAGCCAGGGAAGAGAAGGAGGCAAAAGAGAAGGCTGAAGCAGCGTATG CTCGTAAGCGGAATCGGGAGCGGTACCGTCAAGGAATCACGTGTATGAAGAACTCGACGCTGCCAAATTTTGAAGACATG GACTACAATGAGACTGGATTCTTCAGAGACTATGAAGAGAACCGGAAAAGAGTGGCACAGGAGCACGAAATCGCGATGCA TGCGGCTGCTAAAGCCGCAGAATTGGCGGCGATGCCAGTTTTGCAGTCAATGGCACCCACAGTTGCGATTATGTCAGAGG CGCAAAAAGCGGCGGAAAGTGCAAAGGTTGATACGAATGCATTGGTGTCCGAGTGGTGTGATCGGCTTCCGAACTTTgtg agtttttgtttcttactttggttttcaaaaccatgtattttttttaatcagtaatttctttcgcgttttacgttttacgt tgcttaaaaatacattagacggttagacaaatcgagctgcatcgatggcgcacgatatacatatatgaggatgattgctc atttttcattttttcagCCACCCAACAAAATCGACTTTTCACATCCATCCGACATATCTGCACACTTTGACGGTCCTAAT CCCATCATCAACTTTTCCGACATTCTCAAAGGGAAACTTCCCGGGCTGTCCTCTTCCAATCCAGCATCTGCATCATCTTC CCGGCCTGGAAGTGCCATGAGCAGCAACTTGGCTACTCCAGAAAAGCGATTTGGTCCAGGCCGACCGAAAAAGCCAAAAC CAGAAAACACAGGACCACCCAAACCGAAAGGACGACCACCCAAGAAGGCTACGCTTGAAAAGgtgagtttaattttaata gaaaacgaatataaagatattacgttttcctggaatggtgataccgcgtcaaattgtgtacattgtgttcttgccacgga cggtgtttgcagactgtggatttacgcgcaaatttcaatttttcgaataaattccgtttttcattttgttttatctgtgg aattttaaaatttttccggggtgttgtgaaaacaaaaaaaaattgcaacgcagtgtttgcgtactttcgaaattcaaatg gtgatgaaagaaatagcatagctcgttcaaattttgaaagtacgcaaacacctcgttgcattttttttgttttcacaata gtgttcaacatttttattacgatatgcgaaaaaaaaaatttaaaaattcaaatttgcgcgtaaatacacaagtctgcaaa caccgtccgtggcgagaacacaatgtacacaatttgacgcggtatcaccattccaggaatacgtaataataataaaacta aaaactttgccattttctagAGAAAACGCCTCAGCGATCAGTTGGCTCTGCAGCAGCTCGATGCGGCCAATGAAGGAGAA AAGACTGAAAAGAACGAGGATGCAGAAACTCCTGGGAAGCCCCCAGCTCCGAAAAAACCAAAAAAGAAGGATAGTATCGA TGCGCAAATTCGGGCTCAAATGCTCCGAGCTAAAAGCCAAATGGTTCTACCCAACGCTGCGCATGTGCCTGAGCCAGCTC CAGTACCTTTGATACCTGCTCCAATTCCACTAATAACACCAATGATCGCAGCTCAGATTCTTACAGAAGCTATCAAAGCT TCCCTTCCACCTCCAGCGCCAGCTCCAGCTCCAGTTATTCCAATAGTTGTCGCCGATGTTGTTCCAGCAGTTGGGATGAC GATGGACATTGGAGTGGATATGATAATCAGCGACGAGCCGGCGCTCGAAGTGGAGGTCAAGACTGATGACGTGAAACCGA TTCCGAGTAAACCATCCACCTCCACGGCTCCTCCAACAGAAGATGTCAGTCAGCAGGCGGAGAAGTCAAAAAAAGAAAAG AAGGAGAAAAAGTGGGATAAGGACTCGGAGGAGTACAAGGAGTACAAGCGACAGAAAAAGGAGAAGCGAAGGAAGGAGCG GGAGGAGCGGAAGACGTCTGAAAAGAAGGAGGAGACTCCTGAAAAGAACAAGATGACGGTGATGAGCACCAGTGAGGAAT CGTCGGTGATAGgtgagtattttgtttgtcagggaattttcggcttttagccgaaccctcgtcaaaaatttgctgaaaaa ggttctaactatccgccaataatggctatctgccattttgtattcgatggttaactggtatttttaaaggctaatgccat tgctctaccaaaatgtcggaaaatcgtaattttatgctcattttccgcgttccaactttttttgtgttcttgttttgctt tgtatcctacgttttcgtagagtgaactacattattgtcaagcaaaacttcaaaaaaaaaaacttatctctggcctgcct cccccctgagattatcggcatagacaagtctagagacagaattaaccgaaaaggtgtacgttaattctcgtttttcatat tagttgtcacgtttttcatgtgaagctaggcattttggaacaattttgaaaaaacctatctgaatactcaattcatttgt cttaatttttctcaagtgactgccctcttggtagtgtgccaaatcatgcgaattcacatttttaaagcgaatttttcaga ccgagagcgtgtaagcgatgagacgcagcgttgccacgcgacgcaaccgcagcgcgcggcgtcggcggcaaaaaagggtt tgaaaaaaaggcaggcgtcagcacctcgtgctatcggactaaacgaatacctttaccgtattactcttctcttagctggt gagacctgtgggctaaaatcttccaaaaatatattcagcgcgattggacacagctgaagtgagtatgaccgtagctcatt taaaaaacaagtattgagaaaccaaagaaaaacttaaacgaaaatgtgaaatgtttcctcatttgctatgctaaatattt tttcatatttgtttgaatttttaaagtacacaaacacggtgtcaaaacctttgttttcgctgtaaattttttgaatggat tacggttacactcattttaactgtgtctggtcgtgctgggtttacacgtagaagattttgcattttatagtcctcatctg ccattggctgtaacgaaaataacaatgctttaaaaaatcccgaccgaccaatactgaattaggaatttgcttgtccgttt taaatatcattttgactttaaattagttttgacgtttttttcaaagtttctttttcaaaaatgctgcaacatttaaagat ttcaaaaaagtcttgcaaatttcaaattttatttataatgtccgtgaagtgcggatgaaacgatgagaaaagaaaaaggt cggctaatttcttgactgtcaaaaaaaaagttaagtggaaacattttttctttgtttttgcaagtgttccactattgatc gaattctcatccttgtttaatcgtgttctctgaaattcaaagcaactcaactttaatggctcttccctatgacagagaga gagagagaggaccacatatccatttgcatccaatgtctctttttttgttgtgtttgtcctcaatccattcttgagagaaa aagacactgcatgacgcccagcgaccaagaggacctttttttcctcattttcatgctcccctgatgatttgttgagcgtt gagccagaaacttgctcctctcctctcatttcttatgaatgggaattagaagggtgtgcgtcgggataatcttttgatat ttttcagagctagcactctttgcattaaaaatttctctaaatatcattcgattttctgtaaaatcttcaacttttcctat cctttatttatttcttccagATCCCACACAAAATCCAAAACTCAAGCTCAAAATCAAATTCGGCTCCAACTACGCTTCCC AACCATCAAACAGCGACTCATTGATGCGTCCCGATTCGACAAACCCATCCAGCCGTCCAGCATCGTCGCGTAGCAACTAC CAGGAGCACACAGCGTCCGGCGAAGAGACACCAAAGCTCAATCCGCCATTAAAGTTCCGCTTCAAGAATCTGTTCAATTT AGCGGACAAGGAGGCACAAAAAGGAGAGTCGGCAAAATCGTCGCCCGGAGGAGGTTCCAGACCAGGATCTGCGATGCGAA CTGAGgtaggatttttttaaaattgaaatgtagaattatcccttgccagacattctcaatagaaaatttattttcagACA CCAACCTCGTCATCATCATCAAAGCACCACAAAAAGGATAAAAAGGACAAAGAGCAGAAGAAGCACAAGAAGGAGAAGGA GCAAGATCGTGAGAAGGATCGAGAACGTCAGGAGCGAAAAGAGCGCGAGCGCCAGCAAAAAGAGAAGGAGGAGGCGGCTC AGCGTGAAGTgtacgtgtactggccagtagattaaaaactataatttattgagagtgggagttaagcgctgagagttgat gttttaggcacgcatttccttgtgaattgaacactttatttttttctgcgtctcctctgcggcgagaccacatggccgcg gccgcggccgcgaaacagcgcgtggccgattggcagctttgaatgagaaatgagcaaataatagttgcaaccctaaacac tatttttcagAGAAGAAAAGGCACTCGCCGAACAGGAGGCTGCGAAAAAGACGGCAGACGAAGAAGAGGAGCGTCGTCGT GAGAAGGAGAAGCGTCGCGAGGAGAAGAAGAAGGAGAAGGAGCGTCAAAAGGAGAAGCAGGAGCGACGTGAACGCAAGGA AAAGGAACGTGAAAAGGAGCGAGAAGCGGAACGTGAACGTGAACGAGAAAAGGAGAAGGAAAAGGAAAAAGAAAAGGAGC GGGAGAAGATCAAAGAGAAGGAACGTGAAAAGGAAAAAGAAAAGGAGGAGAAAGAAAAGGAGAAGGAAAAGGAACGTGAA AAGGAACGTGAAAAAGAACGTGAAAAGGAGCGTGAACGTGAAAAGGAACGTGAACGTGAAAGCGAACGAGACCGCAAAAA AGAAGAAGgtaacgatctctctaaacaaatctattaaccctttaataagttctatttagAACGCAAGAAAAAGGAGAAGA AGCGCTCACCACCACTCCCGGCGGCTACTCCCACCCTCGCACCAAGGCCGTTGCTAAAAGAAAACACCGATAACGAGTCG AATCAGAGCTCGGAAGAGCCGGAAGAAGAGGTGTGGGTGTGCCCGGTGTGCAATGTGGCCTACAATGACGGTGCGAATAT GGTGGCGTGCGATCAGTGTGAAGATTGGTTTCATTGgtgagttcatggcgtcgaaaatggaaaaccccttttcttttttt ttgttctagacgttttgatttttaaagaacgaaacgaaagttgcataggcaaataaaaagcgcatgtttgcaagctcttg gagcttgttaacatcttttttccgcaactttttatgtctagttcaagtccgaaagtcaatagagggcaaacatgtaattc tttgaacttttgatctctgggaatttttaatttatagccgacgattataggcggctaacacttgcttacacgccgattgc cgccaaacgcgcgctgatcgccgattcgatgccaaatcacgaggcgcttgcggctatcctcgcaaaagtgcgctccgttg aactgggcggaaaatctagaaagtgtgccaatttaggcgaattcacatttttgaagcgaatttttgagtcggaacgcgtt ttatcgacgagacgcaaacgagagtgaacgttgctacgcgacgcaaccgcagcctattaaactttggcgaccacaatgtg ttccggactaaatttttgaaaacgaattttcgggcgccatttcttgcgtctctgtgtctctatttttgcacgcgtttagc cgaacttggtagaacgctactgtggatatgcagaaaaatgcgatagggcgcgtttgcctttacgtagaggaaaattatat ttcgctacttagcgtgatttttatcattcgttatcttttttctaggaggtgtcaaagtttaaatattatatttctgccta aaaattgtttgaaaaaggcctaaaaagattatgattcgtttcctgagtttagcgcattcatctttttttaattcaaaagc aaaaatgagaagggagtgagtaaacgcatccaaatgaggcacaaaaaataaaaaaagctcgcgaataattttggatagga cctcgtaaatttcacgattttggtttggtttttctctccgataatctgaaattattcgcgcgcattttttattttttggg cctcatttggatgcattgcgtgtacgcattcgggcgcgtttactcacttgtggatttacgcgcaaatttgagtttttaaa tttttttatttcatatttcaaattccatagatttgaaacaaaattaaaattggcacaaataataacggggttcttcacaa aacggaaaaaaaaggaagagaatggaaaaaaaaaacttcaggaaaaattggaaaatgctccgatagacctgaatttcggg aaatactgagtgggcaaagttttcctgtacacgctcacaaaattttggaccaaaatattgattttaaagttatcgatttt tttctgaaattttttaaatcgatattttggtccaaaaatttttgaagagaatttttccaatatttcccaaaatttcaggt caaggagcattctccgatttttcccaaagttttttcggttttgtgaataagcccataacaaaaaaaatggaatttattgt gttttcaatcgagttgcgacgccaagaggtgaaactccgcccactttttttcacgctaacattaaattttattgcatttt gaatttttgcgtgaaaaaaagtgggcggagtttgacctcttgaagtcgcaactcgattgaaaacacaatattcgtcgaaa aatttcgaaataaaacaattcaaaattccttacgtaggtactagcacgtcgtggcggcaagcaagctttaaaaaaaaggc agtcacccatcagccgaccgctgattaggtgccaactatgcataatagttttcttttattttttaacggccggctaattg ccatatctatgccaaaattctctaaatgttcaatttttcttccagGCACTGTGTCAACCTCACAGCTGAGCCCACCGACG CCAAATGGTTCTGTACTCGATGCACCAAGGGCAGCAAGTCGAAAAAGGGCCAAAAACGTGGCGCTAATGGTCCTTCTGAC TCGGCGTCGGCGTCGGCGAAGAGGAAAAAGCATTGA
view unspliced + UTR (8516 bp)
>CJA01181 unspliced + UTR

Lowercase text in transcripts indicates introns and UTRs, UTR sequences having a light gray font. Uppercase, highlighted text in transcripts indicate coding sequence where each subsequent coding exon is highlighted in a different color, alternating between yellow and orange, to differentiate one exon from the next. Beige indicates flanking regions of a transcript.

CJA01181spliced + UTR.fasta
view spliced + UTR (3225 bp)
>CJA01181 spliced + UTR

Lowercase text in transcripts indicates introns and UTRs, UTR sequences having a light gray font. Uppercase, highlighted text in transcripts indicate coding sequence where each subsequent coding exon is highlighted in a different color, alternating between yellow and orange, to differentiate one exon from the next. Beige indicates flanking regions of a transcript.

CJA01181conceptual translation.fasta
view conceptual translation (1074 aa)
>conceptual translation
Predicted Exon Structure:
Exon # Start End Length
Predicted Genes & Transcriptional Units:
Transcripts in this region: