Welcome to WormBase - need help?

e-PCR Search

This search uses Greg Schuler's e-PCR program to search for STSs in the current C. elegans genome. Enter a list of primer pairs to find using the following format:

Name     Left Oligo               Right Oligo              Length
assay_1  CGATAAACAATCAACGGCATAAT  TTTGAAACTGATATAGAGGGGCA  1188
assay_2  AAGGTTATTTATGCGGTGGAAAT  AGCACTTTGAGCTTGATGAAATC  2191
assay_3  AGATTGGAACGATAACGCAGATA  TTTGCCAATTTGCATTTTATTTT  1603

Alternatively, select List of assay names and enter a list of PCR product names already in WormBase to see what genes they intersect.

You may also select List of positions and enter a list of positions in this format:

Name     Position
assay_1  II:4332211..4338292
assay_2  IV:12089228..12091923
e-PCR Search
This is a
Allow product length difference of: bp   Allow oligo mismatches of: bp
Results in:

This may take several minutes to run. Hit the stop or back buttons to abort.