WormBase Tree Display for Construct: WBCnstr00014282
expand all nodes | collapse all nodes | view schema
| WBCnstr00014282 | Public_name | fUL#JW152 | |
|---|---|---|---|
| Other_name | Expr9762_Ex | ||
| Summary | [C07A12.5::GFP; pRF4] | ||
| Driven_by_gene | WBGene00005008 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Transcriptional_fusion | ||
| Construction_summary | Clone = fUL#JW152. The reporter gene fusion assayed was made by recombineering WRM0610dC05. Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: ctccgcagcggaagaaaaaagcgccgaagcgtggcaaacgtcgtggctgg, aacattacctttaaaaaaacttgataaaatttaataaaatataatcttta. gfp was inserted directly upstream of the spr-3 stop codon. No other strains. pRF4 cotransformant: pick rollers to maintain (not integrated). --precise ends. | ||
| Used_for | Transgene_construct | WBTransgene00031207 | |
| Reference | WBPaper00040230 | ||
| Person | WBPerson266 |
