WormBase Tree Display for Construct: WBCnstr00014297
expand all nodes | collapse all nodes | view schema
WBCnstr00014297 | Public_name | fUL#HC23 | |
---|---|---|---|
Other_name | Expr9777_Ex | ||
Summary | [T28F12.2::GFP; pRF4] | ||
Driven_by_gene | WBGene00006796 | ||
Fusion_reporter | GFP | ||
Type_of_construct | Transcriptional_fusion | ||
Construction_summary | Clone = fUL#HC23. The reporter gene fusion assayed was made by recombineering WRM069bE03. Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: acgaccatcgttcatcttattcagcaaggccccgtgtgtcggcaacgacg, agaggggaaacggaatgaaggagaagaagaagaagaagtaccctctgcgc. gfp was inserted immediately after the start codon for transcripts unc-62b/e. This reporter gene fusion was also constructed from WRM061dC01, with more upstream and less downstream genomic DNA (see fUL#HC43). Other strain: UL3571. pRF4 cotransformants: pick rollers to maintain (not integrated). --precise ends. | ||
Used_for | Transgene_construct | WBTransgene00031222 | |
Reference | WBPaper00040230 | ||
Person | WBPerson266 |