WormBase Tree Display for Construct: WBCnstr00014307
expand all nodes | collapse all nodes | view schema
WBCnstr00014307 | Public_name | fUL#HC48 | |
---|---|---|---|
Other_name | Expr9787_Ex | ||
Summary | [T28F12.2::GFP; pRF4] | ||
Driven_by_gene | WBGene00006796 | ||
Fusion_reporter | GFP | ||
Type_of_construct | Transcriptional_fusion | ||
Construction_summary | Clone = fUL#HC48. The reporter gene fusion assayed was made by recombineering WRM061dC01. Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: tctttttcaaaatttaatatttctctcttgcaggaacatgagcggcgac, ctggcgctattccacctttaatatacttttttcataataaattctgaatt. This is fUL#HC40, with gfp inserted immediately upstream of the unc-62 stop codon, but with an additional modification to disrupt exon 1 of transcripts unc-62b and unc-62e specifically. (gtgtgtcggcaacgacgatggcgCagagg has been changed to gtgtgtcggcaacgacgatggcgTagagg.) This reporter gene fusion was also constructed from WRM069bE03, with less upstream and more downstream genomic DNA (see fUL#HC27). Other strain: UL3704. pRF4 cotransformants: pick rollers to maintain (not integrated). --precise ends. | ||
Used_for | Transgene_construct | WBTransgene00031232 | |
Reference | WBPaper00040230 | ||
Person | WBPerson266 |