WormBase Tree Display for Construct: WBCnstr00014317
expand all nodes | collapse all nodes | view schema
WBCnstr00014317 | Public_name | fUL#HC31 | |
---|---|---|---|
Other_name | Expr9797_Ex | ||
Summary | [T28F12.2::GFP; pRF4] | ||
Driven_by_gene | WBGene00006796 | ||
Fusion_reporter | GFP | ||
Type_of_construct | Transcriptional_fusion | ||
Construction_summary | Clone = fUL#HC31. The reporter gene fusion assayed was made by recombineering WRM069bE03. Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: tctttttcaaaatttaatatttctctcttgcaggaacatgagcggcgac, ctggcgctattccacctttaatatacttttttcataataaattctgaatt. This is fUL#HC19, with gfp inserted immediately upstream of the unc-62 stop codon, but with additional modifications to disrupt both of the alternative exon 1s of transcripts unc-62a, unc-62b, unc-62e and unc-62f specifically. (gcaggaacatgagcggcgactCaaaagtgtgggc has been changed to gcaggaacatgagcggcgactAaaaagtgtgggc & gtgtgtcggcaacgacgatggcgCagagg has been changed to gtgtgtcggcaacgacgatggcgTagagg.) This reporter gene fusion was also constructed from WRM061dC01, with more upstream and less downstream genomic DNA (see fUL#HC52). Other strain: UL3931. pRF4 cotransformants: pick rollers to maintain (not integrated). --precise ends. | ||
Used_for | Transgene_construct | WBTransgene00031242 | |
Reference | WBPaper00040230 | ||
Person | WBPerson266 |