WormBase Tree Display for Construct: WBCnstr00018861
expand all nodes | collapse all nodes | view schema
WBCnstr00018861 | Summary | [f57f4.4p::gfp; col-12p::DsRed] | |
---|---|---|---|
Driven_by_gene | WBGene00019017 | ||
Fusion_reporter | GFP | ||
Construction_summary | f57f4.4p::gfp was obtained by PCR fusion. A 2,832 bp fragment upstream of the f57f4.4 start site was amplified using fosmid wrm066be11 as a template (with primers JEP1913-JEP1914). This fragment was mixed with a DNA fragment coding for the GFP (pPD95.75 as a template and primers JEP568-JEP569) and the fusion was performed using primers JEP1912 and JEP570. The f57f4.4p::gfp was injected together with col-12p::DsRed (Pujol et al., 2008a) into N2 worms. Two independent lines were generated showing the same constitutive dsRed expression in the epidermis and inducible gfp in the intestine upon P. luminescens infection. The line used in this study contains the array frEx479. Primers: jep 1912: cggatgctactgcgtgatttgta, jep 1913: tgtactctgaacctggtcaacgg, jep 1914: AGTCGACCTGCAGGCATGCAAGCTctgaaatttgaatgtgttagtg (upper cases represent the part matching JEP 568 for the fusion), jep 568: AGCTTGCATGCCTGCAGGTCGACT, jep 569: AAGGGCCCGTACGGCCGACTAGTAGG, jep 570: GGAAACAGTTATGTTTGGTATATTGGG. | ||
Used_for | Transgene_construct | WBTransgene00019527 | |
Interactor | WBInteraction000520865 | ||
Reference | WBPaper00044159 |