WormBase Tree Display for Construct: WBCnstr00022279
expand all nodes | collapse all nodes | view schema
| WBCnstr00022279 | Public_name | pNH144 | |
|---|---|---|---|
| Summary | [unc-119p::GFP::HAM-1] | ||
| Driven_by_gene | WBGene00006843 | ||
| Gene | WBGene00001820 | ||
| Fusion_reporter | GFP | ||
| Construction_summary | ham-1 constructs were generated in pPD118.15, a promoterless gfp vector containing the let-858 3'UTR. The unc-119 promoter sequence was PCR amplified from the plasmid pBY103 (provided by Morris Maduro) with Phusion High-Fidelity DNA polymerase (New England Biolabs) using primers unc119-1 (5'CATGTCTA GAAAGCTTCAGTAAAAGAAGTAGAATTTTATAG3') and unc119-2 (5' CGATGGTACCCCGTGGAGATCTTATCGATAATGG3') containing XbaI and Kpn1 restriction sites respectively. The 1.2 kb promoter sequence was subcloned into the XbaI and Kpn1 sites of pPD118.15 generating pAL13. The full length ham-1 open reading frame (bp 1-1245) was amplified from plasmid PH1 (provided by Gian Garriga) using primers hm69 (GTACGAATTCATGACCTACTTAGCCGTTGTGC) and hm70 (GACTGAATTCCTACAAATTGGAGATCAGGACGC) containing EcoRI restriction sites and inserted downstream of gfp into the EcoRI site of pAL13 to generate pNH144. | ||
| Used_for | Transgene_construct | WBTransgene00022608 | |
| Reference | WBPaper00049026 |
