WormBase Tree Display for Construct: WBCnstr00042580
expand all nodes | collapse all nodes | view schema
| WBCnstr00042580 | Public_name | pAO30 | |
|---|---|---|---|
| Summary | [Pnlp-3::nlp-3::gfp] | ||
| Driven_by_gene | WBGene00003741 | ||
| Gene | WBGene00003741 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Translational_fusion | ||
| Construction_summary | "To determine the effects of overexrpessing nlp-3 in animals lacking HSN neurons, we generated chromosomally-integrated nlp-3 overexpressing transgenes. Primers 5' cagtcagtcgacgcaatacaaccaatcccttttcatctc 3' and 5' cagtcaggtaccaccaagctaatcaaattttgtcaccg 3' were used to amplify the nlp-3 gene from fosmid genomic clone wrm0613cB03, generating a PCR product with ~3700 bp of promoter and ~900 bp of 3' untranslated region. This was digested with restriction enzymesSalI and KpnI and inserted into Sal1 and Kpn1 digested plasmid vector pUC19..." | ||
| Clone | WRM0613cB03 | ||
| Used_for | Transgene_construct | WBTransgene00025734 | |
| WBTransgene00025735 | |||
| Reference | WBPaper00056096 |
