WormBase Tree Display for Expr_pattern: Expr5305
expand all nodes | collapse all nodes | view schema
Expr5305 | Expression_of | Gene | WBGene00004705 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00004705 | ||||
Homol | Homol_homol | C18D11:Expr | |||
Expression_data | Life_stage (2) | ||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0003822 | |||||
WBbt:0003833 | |||||
WBbt:0004292 | |||||
WBbt:0005175 | |||||
WBbt:0005300 | |||||
WBbt:0005735 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005747 | |||||
WBbt:0005753 | |||||
WBbt:0005772 | |||||
WBbt:0005813 | |||||
WBbt:0006749 | |||||
WBbt:0006751 | |||||
Type | Reporter_gene | [rsp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTATCTGTTCCTCCGTTCAA] 3' and primer B 5' [GAACGATGGCCGATTTTG] 3'. | |||
Pattern | Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ; | ||||
Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing gonad; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ; | |||||
Remark | Also expressed in (comments from author) : Unidentified cells in head and tail, possibly neural. | ||||
Strain: BC10484 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002279 |