WormBase Tree Display for Expr_pattern: Expr5918
expand all nodes | collapse all nodes | view schema
Expr5918 | Expression_of | Gene | WBGene00006062 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00006062 | ||
Homol | Homol_homol | F30A10:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0003679 | ||
WBbt:0003822 | |||
WBbt:0003833 | |||
WBbt:0004292 | |||
WBbt:0004506 | |||
WBbt:0004520 | |||
WBbt:0005300 | |||
WBbt:0005439 | |||
WBbt:0005735 | |||
WBbt:0005747 | |||
WBbt:0005813 | |||
WBbt:0005821 | |||
WBbt:0006748 | |||
WBbt:0006749 | |||
WBbt:0006751 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [stn-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCTTGTCTCTCGCTCAATACA] 3' and primer B 5' [GCCGATCTAATCGGAGCA] 3'. | |
Pattern | Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; tail neurons; | ||
Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing vulva; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; tail neurons; | |||
Picture (4) | |||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product.Mosaic population. | ||
Strain: BC14057 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003386 |