Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5009

expand all nodes | collapse all nodes | view schema

Name Class

Expr5009Expression_ofGeneWBGene00003010
Reflects_endogenous_expression_ofWBGene00003010
HomolHomol_homolB0001:Expr
Expression_data (2)
TypeReporter_gene[B0001.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGAGACCCAACCAAATG] 3' and primer B 5' [TTTTGCCACAGATCATAAAAGGTA] 3'.
PatternAdult Expression: pharynx; intestine; rectal gland cells; Nervous System; nerve ring; ventral nerve cord; head neurons;
Larval Expression: pharynx; intestine; rectal gland cells; Nervous System; nerve ring; ventral nerve cord; head neurons;
RemarkAlso expressed in (comments from author) : iNo comment.
Strain: BC11904
ReferenceWBPaper00006525
TransgeneWBTransgene00002745