WormBase Tree Display for Expr_pattern: Expr5035
expand all nodes | collapse all nodes | view schema
Expr5035 | Expression_of | Gene | WBGene00015103 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00015103 | ||
Homol | Homol_homol | B0280:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005788 | ||
Type | Reporter_gene | [B0280.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCATAAGTATAATTTCATTCCCA] 3' and primer B 5' [CCAAGGTTTTTGATAATATGATGT] 3'. | |
Pattern (2) | |||
Remark | Also expressed in (comments from author) : pharynx: nice dorsal g1 and ventral g1 glands cells. Also ventral g2 | ||
Strain: BC12341 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002897 |