Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5043

expand all nodes | collapse all nodes | view schema

Name Class

Expr5043Expression_ofGeneWBGene00003825
Reflects_endogenous_expression_ofWBGene00003825
HomolHomol_homolB0286:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (22)
TypeReporter_gene[ntl-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCTTGCTCGAACCCCATT] 3' and primer B 5' [GTCGTCTGCTAAGATCTGCAATAA] 3'.
PatternAdult Expression: pharynx; intestine; rectal gland cells; rectal epithelium; Reproductive System; distal tip cell; vulval muscle; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; intestine; rectal gland cells; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons;
Picture (7)
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC15504
ReferenceWBPaper00006525
TransgeneWBTransgene00003994