Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5089

expand all nodes | collapse all nodes | view schema

Name Class

Expr5089Expression_of (2)
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (6)
TypeReporter_gene[rpm-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGCCTTCTGTTTATACAATTTGG] 3' and primer B 5' [GAACGAGATTTGGATATTCTTTGG] 3'.
PatternAdult Expression: pharynx; Nervous System; nerve ring; ventral nerve cord; neurons along body; tail neurons; unidentified cells;
Larval Expression: Nervous System; nerve ring; ventral nerve cord; neurons along body; tail neurons; unidentified cells;
RemarkAlso expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product.
Strain: BC11397
ReferenceWBPaper00006525
TransgeneWBTransgene00002578