WormBase Tree Display for Expr_pattern: Expr5102

Expr5102 Expression_of: Gene: WBGene00015326
    Reflects_endogenous_expression_of: WBGene00015326
  Homol: Homol_homol: C02B10:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0003681
      WBbt:0005319
      WBbt:0005739 Partial
        Remark: unidentified cells
      WBbt:0005747
      WBbt:0005821
  Type: Reporter_gene: [C02B10.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACCATCCGCTTCTAGTCATTGT] 3' and primer B 5' [GAGATTTTCACCAAGAAGTCGG] 3'.
  Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; spermatheca; unidentified cells in head;
    Larval Expression: pharynx; unidentified cells in head;
  Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated.
    Strain: BC11078
  Reference: WBPaper00006525
  Transgene: WBTransgene00002478