Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5103

expand all nodes | collapse all nodes | view schema

Name Class

Expr5103Expression_ofGeneWBGene00003616
Reflects_endogenous_expression_ofWBGene00003616
HomolHomol_homolC02B4:Expr
Expression_data (2)
TypeReporter_gene[nhr-17::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCCTTTCTCTAACTCTTTCGTC] 3' and primer B 5' [TGAAATGAAATAATGAATTGGAGT] 3'.
PatternAdult Expression: pharynx; intestine; rectal gland cells; rectal epithelium; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ;
Larval Expression: pharynx; intestine; rectal gland cells; rectal epithelium; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ;
Picture (5)
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC15179
ReferenceWBPaper00006525
TransgeneWBTransgene00003879