WormBase Tree Display for Expr_pattern: Expr5104
expand all nodes | collapse all nodes | view schema
Expr5104 | Expression_of | Gene | WBGene00001953 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00001953 | ||
Homol | Homol_homol | C02B8:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [hlh-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAGCTTTCAAAATCCCAAACA] 3' and primer B 5' [GCCACGATCTGTGAAAATCATA] 3'. | |
Pattern | Adult Expression: intestine; | ||
Larval Expression: intestine; unidentified cells in body ; | |||
Remark | Also expressed in (comments from author) : There are two cells expressing GFP in the body. | ||
Strain: BC12188 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002855 |