Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5131

expand all nodes | collapse all nodes | view schema

Name Class

Expr5131Expression_of (2)
HomolHomol_homolD2021:Expr
Expression_dataLife_stage (2)
Anatomy_term (11)
TypeReporter_gene[C03G5.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCAGGCTATCCAATGGTTTCT] 3' and primer B 5' [CGGCTCGGAGGATTTTTC] 3'.
PatternAdult Expression: pharynx; intestine; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; intestine; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
PictureWBPicture0000003646
WBPicture0000003647
RemarkStrain: BC12851
ReferenceWBPaper00006525
TransgeneWBTransgene00004315