Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5157

expand all nodes | collapse all nodes | view schema

Name Class

Expr5157Expression_of (2)
HomolHomol_homolCHROMOSOME_III:Expr
Expression_data (2)
TypeReporter_gene[rgs-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATAGACGTTTTCTTCTCCGTTTTT] 3' and primer B 5' [ATATATCCGATGGGCTGGC] 3'.
PatternAdult Expression: Nervous System; nerve ring; head neurons; tail neurons; unidentified cells;
Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
RemarkAlso expressed in (comments from author) : Embryo incomplete. To be updated.
Strain: BC12098
ReferenceWBPaper00006525
TransgeneWBTransgene00002816