Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5175

expand all nodes | collapse all nodes | view schema

Name Class

Expr5175Expression_of (2)
HomolHomol_homolC05D11:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (12)
TypeReporter_gene[C05D11.7b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGATATGATGTTTTGTGTGCG] 3' and primer B 5' [GTGATTTTCTGGAAAAGAACAAAA] 3'.
PatternAdult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; hypodermis; Nervous System; head neurons; tail neurons;
Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; body wall muscle; hypodermis; Nervous System; head neurons; tail neurons;
Picture (4)
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC16156
ReferenceWBPaper00006525
TransgeneWBTransgene00004182