WormBase Tree Display for Expr_pattern: Expr5191
expand all nodes | collapse all nodes | view schema
Expr5191 | Expression_of | Gene | WBGene00018373 | Inferred_automatically |
---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00018373 | |||
Homol | Homol_homol | F43B10:Expr | ||
Expression_data | Life_stage | WBls:0000041 | ||
WBls:0000023 | ||||
Anatomy_term | WBbt:0003681 | |||
WBbt:0003822 | ||||
WBbt:0003833 | ||||
WBbt:0004292 | ||||
WBbt:0005753 | ||||
WBbt:0005813 | ||||
WBbt:0005821 | ||||
WBbt:0005828 | ||||
Type | Reporter_gene | [C06G1.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATAAAATCTGCGCTGTGC] 3' and primer B 5' [ACCCTTTGCTCTCGCAAGT] 3'. | ||
Pattern | Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; vulval muscle; gonad sheath cells; body wall muscle; seam cells; | |||
Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; body wall muscle; seam cells; | ||||
Remark | Strain: BC14332 | |||
Reference | WBPaper00006525 | |||
Transgene | WBTransgene00003506 | |||
Historical_gene | WBGene00015548 | Note: This object originally referred to WBGene00015548. WBGene00015548 is now considered dead and has been merged into WBGene00018373. WBGene00018373 has replaced WBGene00015548 accordingly. |