Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5269

expand all nodes | collapse all nodes | view schema

Name Class

Expr5269Expression_of (2)
HomolHomol_homolC15C7:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (11)
TypeReporter_gene[klp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAACGAATGACCCACTTCTC] 3' and primer B 5' [CTTTTTCCTTGAAGATTTCCAACT] 3'.
PatternAdult Expression: pharynx; anal sphincter; rectal epithelium; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; unidentified cells in head;
Larval Expression: pharynx; anal sphincter; rectal epithelium; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; unidentified cells in head;
Picture (4)
RemarkAlso expressed in (comments from author) : Pharyngeal neuron is probably I3 (Hall Lab, 2005).
Strain: BC11857
ReferenceWBPaper00006525
TransgeneWBTransgene00002723