WormBase Tree Display for Expr_pattern: Expr5285
expand all nodes | collapse all nodes | view schema
Expr5285 | Expression_of | Gene | WBGene00003904 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00003904 | ||
Homol | Homol_homol | C17E4:Expr | |
Expression_data | Life_stage (2) | ||
Anatomy_term | WBbt:0005237 | ||
WBbt:0005300 | |||
WBbt:0005735 | |||
WBbt:0005772 | |||
WBbt:0006749 | |||
WBbt:0006751 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [C17E4.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAGACTAGGCGACGATGA] 3' and primer B 5' [TTATCGCTGATAATGTGAACGAGT] 3'. | |
Pattern | Adult Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; mechanosensory neurons; tail neurons; unidentified cells; | ||
Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; mechanosensory neurons; | |||
Picture (3) | |||
Remark | Also expressed in (comments from author) : Head neurons are mechanosensory, possibly the CEP sensilla. | ||
Strain: BC10478 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002276 |