Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5305

expand all nodes | collapse all nodes | view schema

Name Class

Expr5305Expression_of (2)
HomolHomol_homolC18D11:Expr
Expression_dataLife_stage (2)
Anatomy_term (15)
TypeReporter_gene[rsp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTATCTGTTCCTCCGTTCAA] 3' and primer B 5' [GAACGATGGCCGATTTTG] 3'.
PatternAdult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing gonad; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : Unidentified cells in head and tail, possibly neural.
Strain: BC10484
ReferenceWBPaper00006525
TransgeneWBTransgene00002279