WormBase Tree Display for Expr_pattern: Expr5305
expand all nodes | collapse all nodes | view schema
Expr5305 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | C18D11:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (15) | |||
Type | Reporter_gene | [rsp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTATCTGTTCCTCCGTTCAA] 3' and primer B 5' [GAACGATGGCCGATTTTG] 3'. | |
Pattern (2) | |||
Remark | Also expressed in (comments from author) : Unidentified cells in head and tail, possibly neural. | ||
Strain: BC10484 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002279 |