Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5334

expand all nodes | collapse all nodes | view schema

Name Class

Expr5334Expression_ofGeneWBGene00004308
Reflects_endogenous_expression_ofWBGene00004308
HomolHomol_homolC25D7:Expr
Expression_data (2)
TypeReporter_gene[rap-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAATGAATGGAGCATATTCTTCTG] 3' and primer B 5' [TGAACTCCCTGATTGAGAGTTTTT] 3'.
PatternAdult Expression: pharynx; intestine; rectal gland cells; Reproductive System; uterus; vulval muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in body ;
Larval Expression: pharynx; intestine; rectal gland cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Picture (4)
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC15046
ReferenceWBPaper00006525
TransgeneWBTransgene00003837