WormBase Tree Display for Expr_pattern: Expr5398
expand all nodes | collapse all nodes | view schema
Expr5398 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | C32D5:Expr | |
Expression_data | Life_stage (2) | ||
Anatomy_term | WBbt:0003679 | ||
WBbt:0003681 | |||
WBbt:0005300 | |||
WBbt:0005735 | |||
WBbt:0005753 | |||
WBbt:0005772 | |||
WBbt:0005813 | |||
WBbt:0006749 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [lgg-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCACTTTCAAGGCGACAGTA] 3' and primer B 5' [GCCCACTTGATTTTGATTCG] 3'. | |
Pattern | Adult Expression: pharynx; intestine; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; neurons along body; tail neurons; | ||
Larval Expression: pharynx; intestine; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; neurons along body; tail neurons; | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC13567 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003209 |