WormBase Tree Display for Expr_pattern: Expr5421
expand all nodes | collapse all nodes | view schema
Expr5421 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | C34E10:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (17) | |||
Type | Reporter_gene | [atp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAATTCTGCACTGCAATCAC] 3' and primer B 5' [TAACGAACGCGAAGCGATA] 3'. | |
Pattern (2) | |||
Remark | Also expressed in (comments from author) : Intense GFP expression made it hard to resolve some tissues. | ||
Strain: BC10161 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002116 |