Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5425

expand all nodes | collapse all nodes | view schema

Name Class

Expr5425Expression_of (2)
HomolHomol_homolC34F11:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (8)
TypeReporter_gene[C34F11.9a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGCCACCCAAGCAACTTAC] 3' and primer B 5' [ACTCGGCGATTTTTATGGACT] 3'.
PatternAdult Expression: pharynx; intestine; Reproductive System; vulval muscle; Nervous System; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; intestine; Nervous System; ventral nerve cord; head neurons; tail neurons;
RemarkAlso expressed in (comments from author) : Embryo incomplete. To be updated.
Strain: BC12076
ReferenceWBPaper00006525
TransgeneWBTransgene00002810