Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5434

expand all nodes | collapse all nodes | view schema

Name Class

Expr5434Expression_of (2)
HomolHomol_homolC35D10:Expr
Expression_data (2)
TypeReporter_gene[C35D10.12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTCGTTTGAGCACGCA] 3' and primer B 5' [CCGAACTTATGCTGATACTGTTT] 3'.
Pattern (2)
Remark (2)
ReferenceWBPaper00006525
TransgeneWBTransgene00002908