Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5541

expand all nodes | collapse all nodes | view schema

Name Class

Expr5541Expression_of (2)
HomolHomol_homolC49H3:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (15)
TypeReporter_gene[C49H3.6a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TATTGCGGAGGGATTCTGAC] 3' and primer B 5' [TTGGGATCGTGAAAGAAACA] 3'.
PatternAdult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Nervous System; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells;
Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells;
Picture (5)
RemarkAlso expressed in (comments from author) : Mosaic population.
Strain: BC10241
ReferenceWBPaper00006525
TransgeneWBTransgene00002151