WormBase Tree Display for Expr_pattern: Expr5618
expand all nodes | collapse all nodes | view schema
| Expr5618 | Expression_of (2) | ||
|---|---|---|---|
| Homol | Homol_homol | D2007:Expr | |
| Expression_data (2) | |||
| Type | Reporter_gene | [D2007.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCAAACGGACATACATCAAA] 3' and primer B 5' [CAGCGATTGATCCTGAACATTA] 3'. | |
| Pattern (2) | |||
| Remark (2) | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002946 | ||
| Historical_gene | WBGene00017043 | Note: This object originally referred to WBGene00017043. WBGene00017043 is now considered dead and has been merged into WBGene00017042. WBGene00017042 has replaced WBGene00017043 accordingly. |
