WormBase Tree Display for Expr_pattern: Expr5659
expand all nodes | collapse all nodes | view schema
Expr5659 | Expression_of | Gene | WBGene00004204 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00004204 | ||
Homol | Homol_homol | T05E11:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (5) | |||
Type | Reporter_gene | [psa-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATAAGGCTCCAGCTGCAAGA] 3' and primer B 5' [CCTTCCGCTGATTCTTCAAA] 3'. | |
Pattern | Adult Expression: intestine - ant and post cells; rectal epithelium; unidentified cells in head; unidentified cells in tail ; | ||
Larval Expression: intestine - ant and post cells; rectal epithelium; hypodermis; unidentified cells in head; unidentified cells in tail ; | |||
Picture | WBPicture0000004557 | ||
WBPicture0000009127 | |||
WBPicture0000009128 | |||
WBPicture0000009129 | |||
Remark | Also expressed in (comments from author) : unidentified cells in head and tail, possibly neural.Strain not available. | ||
Strain: BC11211 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004223 |