WormBase Tree Display for Expr_pattern: Expr5705
expand all nodes | collapse all nodes | view schema
| Expr5705 | Expression_of | Gene | WBGene00017313 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00017313 | ||
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0003681 | ||
| WBbt:0004292 | |||
| WBbt:0005733 | |||
| WBbt:0005813 | |||
| Type | Reporter_gene | [F09G2.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGTGTATTTTCATAAACGGTCG] 3' and primer B 5' [GTGTCTTTTAGGTTTTCCCGC] 3'. | |
| Pattern | Adult Expression: pharynx; anal depressor muscle; body wall muscle; hypodermis; | ||
| Larval Expression: pharynx; anal depressor muscle; body wall muscle; hypodermis; | |||
| Picture | WBPicture0000004657 | ||
| WBPicture0000004658 | |||
| WBPicture0000004659 | |||
| Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
| Strain: BC15721 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00004072 |
