Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5749

expand all nodes | collapse all nodes | view schema

Name Class

Expr5749Expression_ofGeneWBGene00002262
Reflects_endogenous_expression_ofWBGene00002262
HomolHomol_homolF13D12:Expr
Expression_dataLife_stage (2)
Anatomy_term (10)
TypeReporter_gene[idh-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGGATTGAATTTCTCAGTTTTGA] 3' and primer B 5' [TTGCGATGCTGAAAGAAATG] 3'.
PatternAdult Expression: rectal epithelium; Reproductive System; vulva other; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in tail ;
Larval Expression: rectal epithelium; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in tail ;
RemarkStrain: BC13826
ReferenceWBPaper00006525
TransgeneWBTransgene00003297