Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5757

expand all nodes | collapse all nodes | view schema

Name Class

Expr5757Expression_of (2)
HomolHomol_homolF14D12:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (12)
TypeReporter_gene[F14D12.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTATTTTTGGATTTCTTCCTC] 3' and primer B 5' [TAAGGTTCCAGATTATGTGATGTT] 3'.
PatternAdult Expression: intestine; Reproductive System; uterine muscle; spermatheca; gonad sheath cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in body ;unidentified cells in tail ;
Larval Expression: intestine; Reproductive System; developing spermatheca; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in body ;unidentified cells in tail ;
Picture (5)
RemarkStrain: BC11539
ReferenceWBPaper00006525
TransgeneWBTransgene00002617