WormBase Tree Display for Expr_pattern: Expr5793
expand all nodes | collapse all nodes | view schema
| Expr5793 | Expression_of | Gene | WBGene00008948 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00008948 | ||
| Homol | Homol_homol | F19B6:Expr | |
| Expression_data (2) | |||
| Type | Reporter_gene | [F19B6.1b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCCCTCCTTTGACATTAGAA] 3' and primer B 5' [TGCGACGATCCTGAAAATAAC] 3'. | |
| Pattern | Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; hypodermis; | ||
| Larval Expression: pharynx; body wall muscle; hypodermis; | |||
| Picture | WBPicture0000004815 | ||
| Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
| Strain: BC11255 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002532 |
