Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5823

expand all nodes | collapse all nodes | view schema

Name Class

Expr5823Expression_ofGeneWBGene00009050
Reflects_endogenous_expression_ofWBGene00009050
HomolHomol_homolF22D6:Expr
Expression_dataLife_stage (2)
Anatomy_term (11)
TypeReporter_gene[F22D6.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCCACGTGTACACCACACC] 3' and primer B 5' [TCTCGATTGGTGGACCTGA] 3'.
PatternAdult Expression: pharynx; intestine; Reproductive System; vulval muscle; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; intestine; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Picture (4)
RemarkStrain: BC11040
ReferenceWBPaper00006525
TransgeneWBTransgene00002456