WormBase Tree Display for Expr_pattern: Expr5827
expand all nodes | collapse all nodes | view schema
Expr5827 | Expression_of | Gene | WBGene00004006 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00004006 | ||
Homol | Homol_homol | F22E10:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [pgp-12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGCTTGCAGTGAACCAGAA] 3' and primer B 5' [TTACGCCACTTGATGTTTAACCTA] 3'. | |
Pattern | Adult Expression: pharynx; hypodermis; excretory cell; unidentified cells in head; unidentified cells in tail ; | ||
Embryo Expression: intestine; excretory cell; | |||
Larval Expression: pharynx; excretory cell; unidentified cells in head; | |||
Remark | Also expressed in (comments from author) : unidentified cells in head and tail | ||
Strain: BC10210 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002070 |