Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5827

expand all nodes | collapse all nodes | view schema

Name Class

Expr5827Expression_ofGeneWBGene00004006
Reflects_endogenous_expression_ofWBGene00004006
HomolHomol_homolF22E10:Expr
Expression_data (2)
TypeReporter_gene[pgp-12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGCTTGCAGTGAACCAGAA] 3' and primer B 5' [TTACGCCACTTGATGTTTAACCTA] 3'.
PatternAdult Expression: pharynx; hypodermis; excretory cell; unidentified cells in head; unidentified cells in tail ;
Embryo Expression: intestine; excretory cell;
Larval Expression: pharynx; excretory cell; unidentified cells in head;
RemarkAlso expressed in (comments from author) : unidentified cells in head and tail
Strain: BC10210
ReferenceWBPaper00006525
TransgeneWBTransgene00002070