WormBase Tree Display for Expr_pattern: Expr5827
expand all nodes | collapse all nodes | view schema
Expr5827 | Expression_of | Gene | WBGene00004006 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00004006 | ||||
Homol | Homol_homol | F22E10:Expr | |||
Expression_data | Life_stage (3) | ||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005733 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
WBbt:0005812 | |||||
Type | Reporter_gene | [pgp-12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGCTTGCAGTGAACCAGAA] 3' and primer B 5' [TTACGCCACTTGATGTTTAACCTA] 3'. | |||
Pattern | Adult Expression: pharynx; hypodermis; excretory cell; unidentified cells in head; unidentified cells in tail ; | ||||
Embryo Expression: intestine; excretory cell; | |||||
Larval Expression: pharynx; excretory cell; unidentified cells in head; | |||||
Remark | Also expressed in (comments from author) : unidentified cells in head and tail | ||||
Strain: BC10210 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002070 |