Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5829

expand all nodes | collapse all nodes | view schema

Name Class

Expr5829Expression_ofGeneWBGene00002224
Reflects_endogenous_expression_ofWBGene00002224
HomolHomol_homolF22F4:Expr
Expression_data (2)
TypeReporter_gene[klp-13::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTTTTGCGTCTCAAGATTGC] 3' and primer B 5' [TGTACATGTCTCGGACAGAGC] 3'.
PatternAdult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; tail neurons; phasmids;
Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; tail neurons; phasmids;
Picture (3)
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC11796
ReferenceWBPaper00006525
TransgeneWBTransgene00002696